View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_123 (Length: 205)
Name: NF10179_low_123
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_123 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 31163991 - 31163818
Alignment:
| Q |
18 |
aacatgtgcacaagaaattggacctatagagaaaattatcacaaccacagttaatcctgctgtagctgcatattccaaaaggccaactgcaccattttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31163991 |
aacatgtgcacaagaaattggacctatagagaaaattatcacaaccacagttaatcctgctgtagctgcatattccaaaaggccaactgcaccattttgg |
31163892 |
T |
|
| Q |
118 |
tgttgtgtgcttgcaatgattccacacacacaaaacatcaatataaaagtacccaccacctctgccattaccta |
191 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31163891 |
tgttgtgtgcttgcaatgattccacatacacaaaacatcaatataaaagtacccaccacctctgccattaccta |
31163818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 84 - 191
Target Start/End: Complemental strand, 11157404 - 11157297
Alignment:
| Q |
84 |
tgcatattccaaaaggccaactgcaccattttggtgttgtgtgcttgcaatgattccacacacacaaaacatcaatataaaagtacccaccacctctgcc |
183 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||| |||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11157404 |
tgcatactccaaaaggccaactgcaccattttgatgttgtatgcttggaatgattccacatacacaaaacatcaatataaaagtacccaccacctccgcc |
11157305 |
T |
|
| Q |
184 |
attaccta |
191 |
Q |
| |
|
|||||||| |
|
|
| T |
11157304 |
attaccta |
11157297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University