View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_124 (Length: 204)
Name: NF10179_low_124
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_124 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 7745942 - 7745761
Alignment:
| Q |
8 |
aaaatgtagcatgtcttggatttgtggatggtggtaatgagccaagaactgctgttgtgattggtggacaccaattggaggacaatctattggagtttga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7745942 |
aaaatgtagcatgtcttggatttgtggatggtggtaatgagccaagaactgctgttgtgattggtggacaccaattggaggacaatctattggagtttga |
7745843 |
T |
|
| Q |
108 |
tttggtttcttctaaattaggattctcttctttgctccaacaagatgcaagttgttccagatcagaatagtaaaagtttcat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7745842 |
tttggtttcttctaaattaggattctcttccttgctccaacaagatgcaagttgttccagatcagaatagtaaaagtttcat |
7745761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 8 - 173
Target Start/End: Original strand, 7711650 - 7711818
Alignment:
| Q |
8 |
aaaatgtagcatgtcttggatttgtggatggtggtaatgagccaagaactgctgttgtgattggtggacaccaattggaggacaatctattggagtttga |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7711650 |
aaaatgttgcatgtcttggatttgtggatggtggtaaagagccaagaacagctgttgtgattggtggacaccaattggaggacaatctattggagtttga |
7711749 |
T |
|
| Q |
108 |
tttggtttcttctaaattaggatt---ctcttctttgctccaacaagatgcaagttgttccagatcaga |
173 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| ||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
7711750 |
tttgatttcttctaaattaggattcagctcttccttgctccttcaaaatggaagttgttccagatcaga |
7711818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 8 - 166
Target Start/End: Original strand, 7733960 - 7734121
Alignment:
| Q |
8 |
aaaatgtagcatgtcttggatttgtggatggtggtaatgagccaagaactgctgttgtgattggtggacaccaattggaggacaatctattggagtttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
7733960 |
aaaatgtagcatgtcttggatttgtggatggtggtaaagagccaagaacagctgttgttattggtggacaccagttggaggacattgtattggagtttga |
7734059 |
T |
|
| Q |
108 |
tttggtttcttctaaattaggatt---ctcttctttgctccaacaagatgcaagttgttcca |
166 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
7734060 |
tttggtttcttctaaattaggattcagctcttccttgctccttcaaaatgcaagttgttcca |
7734121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 8 - 132
Target Start/End: Original strand, 7726538 - 7726662
Alignment:
| Q |
8 |
aaaatgtagcatgtcttggatttgtggatggtggtaatgagccaagaactgctgttgtgattggtggacaccaattggaggacaatctattggagtttga |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
7726538 |
aaaatgttgcatgtcttggatttgtggatggtggtaaagagccaagaacagctgttgttattggtggacaccagttggaggacattgtattggagtttga |
7726637 |
T |
|
| Q |
108 |
tttggtttcttctaaattaggattc |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7726638 |
tttggtttcttctaaattaggattc |
7726662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 8 - 132
Target Start/End: Original strand, 7704328 - 7704452
Alignment:
| Q |
8 |
aaaatgtagcatgtcttggatttgtggatggtggtaatgagccaagaactgctgttgtgattggtggacaccaattggaggacaatctattggagtttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||| | |||| |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
7704328 |
aaaatgtagcatgtcttggatttgtggatggtggtaaagaaccaagaagatcaattgttattggtgggcaccaattggaggagaatctattggagtttga |
7704427 |
T |
|
| Q |
108 |
tttggtttcttctaaattaggattc |
132 |
Q |
| |
|
||| |||||||| |||||||||||| |
|
|
| T |
7704428 |
tttagtttcttccaaattaggattc |
7704452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 8 - 132
Target Start/End: Original strand, 7699627 - 7699751
Alignment:
| Q |
8 |
aaaatgtagcatgtcttggatttgtggatggtggtaatgagccaagaactgctgttgtgattggtggacaccaattggaggacaatctattggagtttga |
107 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |||||| ||| | ||||| |||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
7699627 |
aaaaggtagcaagtcttggatttgtggatggtggtaaaaagccaacaacatcagttgttattggtgggcaccaattggaggacaatctactggagtttga |
7699726 |
T |
|
| Q |
108 |
tttggtttcttctaaattaggattc |
132 |
Q |
| |
|
||| ||||| ||||||||||||||| |
|
|
| T |
7699727 |
tttagtttcatctaaattaggattc |
7699751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 125
Target Start/End: Complemental strand, 7766744 - 7766681
Alignment:
| Q |
62 |
ttgtgattggtggacaccaattggaggacaatctattggagtttgatttggtttcttctaaatt |
125 |
Q |
| |
|
|||| ||||||||||| |||||||| |||||||| |||| ||||||||||| |||||| ||||| |
|
|
| T |
7766744 |
ttgttattggtggacatcaattggaagacaatcttttggtgtttgatttggcttcttccaaatt |
7766681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 125
Target Start/End: Complemental strand, 7774071 - 7774008
Alignment:
| Q |
62 |
ttgtgattggtggacaccaattggaggacaatctattggagtttgatttggtttcttctaaatt |
125 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| |||| ||||||||| | |||||| ||||| |
|
|
| T |
7774071 |
ttgttattggtggacatcaattggaggacaatcttttggtgtttgatttagcttcttccaaatt |
7774008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University