View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_30 (Length: 369)
Name: NF10179_low_30
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 9 - 355
Target Start/End: Complemental strand, 32383727 - 32383380
Alignment:
| Q |
9 |
agcaaaggctcggataatggttcagttacatatggatttgcttttgttgattgtgcttgtcttaggttatgggttggttctattgatgatgatgcgtcat |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32383727 |
agcaatggctcggataatggttcagttacatatggatttgcttttgttgattgtgctcgtcttaggttatgggttggttctattgatgatgatgcgtcat |
32383628 |
T |
 |
| Q |
109 |
gttctgctttgggggctttattgatgcaagtatgctcaaaattcccttccttaactggttcctatttttggatgtagtttctgtgattgatcttttaata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32383627 |
gttctgctttgggggctttattgatgcaagtatgctcaaaattcccttccttaactggttcctatttttggatgtaatttctgtgattgatcttttaata |
32383528 |
T |
 |
| Q |
209 |
tgtcaaattgtt-gctaatttgcttatgtgaatgcaatcttaggtgtcacccaaggaaattatatatgaacgcagaggtgaacagtcttatttctttgcc |
307 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32383527 |
tgtcaaattgttagctaatttgcttatgtgaatgcaatcttaggtgtcacccaaggaaattatatatgaacgcagaggtgaacagtcttatttctttgcc |
32383428 |
T |
 |
| Q |
308 |
tttagcttgaacacacttcaattctgtaccttatataggattatttct |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32383427 |
tttagcttgaacacacttcaattctgtaccttacataggattatttct |
32383380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University