View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_31 (Length: 353)
Name: NF10179_low_31
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 202 - 326
Target Start/End: Original strand, 15016673 - 15016797
Alignment:
| Q |
202 |
tatgtgaaaagaggtggttatggtaataattgtatcaaagtggtaagaaagaaagatgtgacaggacactagtggatcatatcagagaggagcctctctc |
301 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15016673 |
tatgtgaaaagaggtggtgatagtaataattgtatcaaagtggtaagaaagaaagatgtgacaggacactagtggatcatatcagagaggagcctctctc |
15016772 |
T |
 |
| Q |
302 |
cgcagctatattatgactctaagct |
326 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15016773 |
cgcagctatattatgactctaagct |
15016797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University