View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_51 (Length: 295)
Name: NF10179_low_51
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 91 - 286
Target Start/End: Complemental strand, 6169189 - 6168996
Alignment:
| Q |
91 |
ttgtttagtttctaaacttttgtctcaaaggttcccctaaagataattctaattccacgttgacaaacttaggatttgtatttatcaaaagcttcttcat |
190 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
6169189 |
ttgtttagtttctaaactttggtctcaaaggttcctctaaagataattctaattccacgttgacaaacttaggatttgt--ttatcaaaagtttcttcat |
6169092 |
T |
|
| Q |
191 |
aattatttatcacaaactaatacgattttagaggtgtccttgcataatcttcttttctataggtttgtttgatcttatttcttattattgcctttg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169091 |
aattatttatcacaaactaatacgattttagaggtgtccttgcataatcttcttttctttaggtttgtttgatcttatttcttattattgcctttg |
6168996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University