View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_53 (Length: 290)
Name: NF10179_low_53
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 160 - 280
Target Start/End: Original strand, 19962380 - 19962499
Alignment:
| Q |
160 |
tggtttcttgaacccttcttcatcttcctttcctcaacttcctcccctaccccccgtatcaccaccatcatccatggcggcatcaattttggtcgttttg |
259 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
19962380 |
tggtttcttgaacccttcttcatcatcctttcctcaccttcttcccctacccc-cgtatcaccaccatcatccatggcggcaccaactttggtcgttttg |
19962478 |
T |
 |
| Q |
260 |
tctccgctgcaaccgtctctg |
280 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
19962479 |
tctctactgcaaccgtctctg |
19962499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 5e-31; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 208 - 280
Target Start/End: Original strand, 1971415 - 1971487
Alignment:
| Q |
208 |
accccccgtatcaccaccatcatccatggcggcatcaattttggtcgttttgtctccgctgcaaccgtctctg |
280 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1971415 |
accctccgtatcaccaccatcatccatggcggcatcaattttggtcgttttgtctccgctgcaaccgtctctg |
1971487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 43 - 130
Target Start/End: Complemental strand, 37362487 - 37362401
Alignment:
| Q |
43 |
tctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttctgtcacattttgattaaaca |
130 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37362487 |
tctccatta-tttgttcaatactgatgcaaactctacagagccccatgcttccctcttcttctccctctgtcacattttgattaaaca |
37362401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 1971275 - 1971365
Alignment:
| Q |
27 |
atgttactatctcacctctccattaatt------tgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttct |
111 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
1971275 |
atgttactatctcacctctccattatttatttattgttcaataccaatgcaaactctacagagccccatgcttccctcttcttctccttct |
1971365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 7841460 - 7841512
Alignment:
| Q |
52 |
atttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttct |
105 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
7841460 |
atttgttcaatacca-tgcaaactctacagaaccccatgcttccctcttcttct |
7841512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 1971360 - 1971400
Alignment:
| Q |
173 |
ccttcttcatcttcctttcctcaacttcctcccctaccccc |
213 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
1971360 |
ccttcttcatcttcctttcctcaccttcttcccctaccccc |
1971400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 27 - 126
Target Start/End: Original strand, 41810349 - 41810445
Alignment:
| Q |
27 |
atgttactatctcacctctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttctgtcacattttgatta |
126 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
41810349 |
atgttattatcacacctctccatta--ttgttcaatacccatgcaaactctacagtgccccatgcttccctcttcttctccctctgtcac-ttttgatta |
41810445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 27 - 126
Target Start/End: Complemental strand, 31770966 - 31770870
Alignment:
| Q |
27 |
atgttactatctcacctctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttctgtcacattttgatta |
126 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
31770966 |
atgttattatcacacctctccatta--ttgttcaatacccatgcaaactctacagtgccccatgcttccctcttcttctccctctgtcac-ttttgatta |
31770870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 28 - 106
Target Start/End: Complemental strand, 7607977 - 7607901
Alignment:
| Q |
28 |
tgttactatctcacctctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctc |
106 |
Q |
| |
|
||||| |||| ||||||||||||| |||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
7607977 |
tgttattatcacacctctccatta--ttgttcaatacccatgcaaactctacagtgccccatgcttccctcttcttctc |
7607901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 39 - 126
Target Start/End: Original strand, 52130959 - 52131043
Alignment:
| Q |
39 |
cacctctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctctttctgtcacattttgatta |
126 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
52130959 |
cacctctccatta--ttgttcaataccgatgcaaactctacagtgccccatgcttccctcttcttctccctctgtcac-ttttgatta |
52131043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 53689434 - 53689487
Alignment:
| Q |
52 |
atttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttct |
105 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53689434 |
atttgttcaataccgatgcaaactctacagagccccatgcttccctcttcttct |
53689487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 106
Target Start/End: Complemental strand, 52311539 - 52311477
Alignment:
| Q |
43 |
tctccattaatttgttcaataccaatgcaaactgtacagagccccatgcttccctcttcttctc |
106 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
52311539 |
tctccatta-tttgttcaataccgatgcaaactctacagagccccatgttgccctcttcttctc |
52311477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University