View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_54 (Length: 289)
Name: NF10179_low_54
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 15 - 274
Target Start/End: Original strand, 34012197 - 34012456
Alignment:
| Q |
15 |
gatgatgacatcgacgatatcgtcaacaacgaggttgttaacgatagcgacgagtacgaggaggacgagtatcagtatcactacgaagaagattatgaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34012197 |
gatgatgacatcgacgatatcgtcaacaacgaggttgttaacgatagcgacgagtacgaggaggacgagtatcagtatcactacgaagaagatgatgaaa |
34012296 |
T |
|
| Q |
115 |
aagaagaaaccaaacagccacaaaaacgttgttcatcttctttttcattgagtaaggtattacttgatccaagaggaaaatgggctgaagaatggaatag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012297 |
aagaagaaaccaaacagccacaaaaacgttgttcatcttctttttcattgagtaaggtattacttgatccaagaggaaaatgggctgaagaatggaatag |
34012396 |
T |
|
| Q |
215 |
agtatttcttttggtgtgtgcaatggggttatttgtggacccacttttcttctatgcaat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012397 |
agtatttcttttggtgtgtgcaatggggttatttgtggacccacttttcttctatgcaat |
34012456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University