View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_72 (Length: 268)
Name: NF10179_low_72
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 42619303 - 42619061
Alignment:
| Q |
19 |
cacctgttgtaaaattaacaattgcatgacttctctttgctattgtgtcttctaaaaactagtttattcattattagacgttcataatatgtattcacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42619303 |
cacctgttgtaaaattaacaattgcatgacttctctttgctattgtgtcttctaaaaactagtttattcattattagacgttcataatatgtattcacaa |
42619204 |
T |
|
| Q |
119 |
gtaaatttcaaagaggtttacatacaattccgtaccacttggccttacaactaataaacctaatcatttctgccaattgcttaaattcatttatggacta |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42619203 |
gtaaatttcaaagaggtttacatgcaattacgtaccacttggccttacaactaataaacctaatcatttctgccaattgcttaaattcatttatggacta |
42619104 |
T |
|
| Q |
219 |
aagcaatcaagtagacaatcattcttcaagctttcctatgctt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42619103 |
aagcaatcaagtagacaatcattcttcaagctttcctatgctt |
42619061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University