View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_78 (Length: 255)
Name: NF10179_low_78
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_78 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 3 - 246
Target Start/End: Complemental strand, 34719740 - 34719507
Alignment:
| Q |
3 |
tctcttctcgtgttatattcatgatagaagttttaataacaatatcatttctgttttcaaacattgtaatgttcagtaaaaacggttttttgttggtttc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34719740 |
tctcttctcgtgttatattcatgatagaagttttaataacaatatcatttctgttttcaaacattgtaatgttcagtaaaaacggttttttgttggtttc |
34719641 |
T |
|
| Q |
103 |
tattcaaagtttagtaaacaggacttaaaataaaaatgagatgatatttttataaactgaaannnnnnnnnnnnnnnnnnnnnntcctgaaatcaaaatg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
34719640 |
tattcaaagtttagtaaacaggacttaaaataaaaatgagatgatgtttttataaactgaaa----------atatatatatattcctgaaatcaaaatg |
34719551 |
T |
|
| Q |
203 |
acccttatcaattcaattctagctgtaccttagttccctatgct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34719550 |
acccttatcaattcaattctagctgtaccttagttccctttgct |
34719507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University