View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_79 (Length: 254)
Name: NF10179_low_79
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 40826520 - 40826762
Alignment:
| Q |
1 |
gtgataatgagacgataatatgtgaattatgttagaacttacgcaacagaagttttttataaatctatataaggtcactaacacttgataaaagatttgt |
100 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40826520 |
gtgataatgaaacaataatatgtgaattatgttggaacctacgcaacagaagttttttataaatctatataaggtcactaacacttgataaaagatttgt |
40826619 |
T |
|
| Q |
101 |
tctcaattttaattaaacttctcgctcttctaaaattttcactaacttgaacgtaaaagtccttgcacgtaggtacactatccgtcatggagcaccaacg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40826620 |
tctcaattttgattaaacttctcgctcttctaaaattttcactaacttgaacgtaaaagttcttgcacgtaggtacactatttgtcatggagcaccaacg |
40826719 |
T |
|
| Q |
201 |
atatcctttgacatatacaaacaactcacatcgtcgtcttcat |
243 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40826720 |
atgtcctttgacatatacaaacaactcccatcgtcgtcttcat |
40826762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University