View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_83 (Length: 251)
Name: NF10179_low_83
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_83 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 4224784 - 4224598
Alignment:
| Q |
1 |
tatcatcaaaatttatgggcttatgttctttaatcaattttggtgtaacatgttgatcttgtcccttaatagatacgaaatcaatgaattaataatatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4224784 |
tatcatcaaaatttatgggcttatgttctttaatcaattttggtgtaacatgttgatcttgtcccttagaagatacgaaatcaatgaattaataatatgc |
4224685 |
T |
|
| Q |
101 |
attatctttatagtgtaacttctaactgtacccatatatataggaagggtttatgccgacaagctagctagttttggtcacaccatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4224684 |
attatctttatagtgtaacttctaactgtacccatatatataggaagggtttttgccgacaagctagctagttttggtcacaccatt |
4224598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 28799207 - 28799259
Alignment:
| Q |
1 |
tatcatcaaaatttatgggcttatgttctttaatcaattttggtgtaacatgt |
53 |
Q |
| |
|
|||| |||||| ||| ||| ||||||||||||| |||||||||| |||||||| |
|
|
| T |
28799207 |
tatcgtcaaaacttaagggtttatgttctttaaccaattttggtctaacatgt |
28799259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University