View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_85 (Length: 250)
Name: NF10179_low_85
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 21435758 - 21435520
Alignment:
| Q |
1 |
ttctgttaggaaatcaaaggtgccattgattcaactgttgttgactgtttgaatattgtgtagcgcatacgttttagtttgaaggcgtgtccgatgtcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21435758 |
ttctgttaggaaatcaaaggtgccattgattcaactgttgttgactgtttgaatattgtgtaccgcatacgttttagtttgaaggcgtgtccgatgtcca |
21435659 |
T |
 |
| Q |
101 |
tgttagatattcctgtctatcactgtttcatcaactgttacttaaatgcaatatgtttaacacctgatactataattgaagtacttagttgacgaaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21435658 |
tgttagatattcctgtctatcactgtttcatcaactgttacttaaatgcaatatgtttaacacctgatactataattgaagtacttagttgacgaaacca |
21435559 |
T |
 |
| Q |
201 |
atagaataatcaaaatctttcactcattaaactcttcat |
239 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
21435558 |
atagaatacgccaaatctttcactcattaaactcttcat |
21435520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 219
Target Start/End: Complemental strand, 27154269 - 27154219
Alignment:
| Q |
169 |
actataattgaagtacttagttgacgaaaccaatagaataatcaaaatctt |
219 |
Q |
| |
|
||||||||||||||| |||| ||| |||| ||||||||||| ||||||||| |
|
|
| T |
27154269 |
actataattgaagtaattaggtgaggaaagcaatagaataagcaaaatctt |
27154219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University