View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_88 (Length: 250)
Name: NF10179_low_88
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 53823633 - 53823870
Alignment:
| Q |
1 |
aacttctagattaatatagtcacaatctattttcataatgaacgcgtaaaagaaattagtaagccggtttttggaaccatagcagcctctaactgaagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53823633 |
aacttctagattaatatagtcacaatct-ttttcataatgaacgcgtaaaagaaattagtaagccggtttttggaaccatagcagcctctaactgacgca |
53823731 |
T |
 |
| Q |
101 |
tgttttcaacgctacgtaaggccattaatgaattcgttgtagtttttgtccagttggacaaccaaaagtgcaagtgaccaaaacaagacaagtaatgctt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53823732 |
tgttttcaacgctacgcaaggccattaatgaattagttgtagtttttgtcaagttggactaccaaaagtgcaagtgaccaaaacaagacaagtaatgctt |
53823831 |
T |
 |
| Q |
201 |
tgtgtatacttcacattcatttcacccatatttgcctat |
239 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53823832 |
tgtgtatacttcacattcatttcattcatatttgcctat |
53823870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University