View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10179_low_91 (Length: 248)

Name: NF10179_low_91
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10179_low_91
NF10179_low_91
[»] chr2 (1 HSPs)
chr2 (108-239)||(34011664-34011796)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 108 - 239
Target Start/End: Complemental strand, 34011796 - 34011664
Alignment:
108 aatgagttttagatcaaagaagaagtcgtcggagctcaaactcacactatttgttggttcaatttcatctgtttgtattttggttgatagctgctgtgca 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34011796 aatgagttttagatcaaagaagaagtcgtcggagctcaaactcacactatttgttggttcaatttcatctgtttgtattttggttgatagctgctgtgca 34011697  T
208 ggtgcctttactatg-aattaccacgttttcat 239  Q
    ||||||||||||||| |||||||||| ||||||    
34011696 ggtgcctttactatgaaattaccacgatttcat 34011664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University