View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_low_91 (Length: 248)
Name: NF10179_low_91
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_low_91 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 108 - 239
Target Start/End: Complemental strand, 34011796 - 34011664
Alignment:
| Q |
108 |
aatgagttttagatcaaagaagaagtcgtcggagctcaaactcacactatttgttggttcaatttcatctgtttgtattttggttgatagctgctgtgca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34011796 |
aatgagttttagatcaaagaagaagtcgtcggagctcaaactcacactatttgttggttcaatttcatctgtttgtattttggttgatagctgctgtgca |
34011697 |
T |
 |
| Q |
208 |
ggtgcctttactatg-aattaccacgttttcat |
239 |
Q |
| |
|
||||||||||||||| |||||||||| |||||| |
|
|
| T |
34011696 |
ggtgcctttactatgaaattaccacgatttcat |
34011664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University