View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1017_low_5 (Length: 272)
Name: NF1017_low_5
Description: NF1017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1017_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 52 - 262
Target Start/End: Complemental strand, 31004597 - 31004387
Alignment:
| Q |
52 |
agaaaaacttaccatctcaatcaaaattgtgataataaaaattgcgttaatgaaagattttatctagcattatgatgtgcttgtctactgctataatcta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31004597 |
agaaaaacttaccatctcaatcaaaattgtgataataaaaattgcgttaatgaaagattttatctagcattatgatgtgcttgtctactgctataatcta |
31004498 |
T |
 |
| Q |
152 |
gtttatatatttaaagatagattaagctgaggcagtttccattgtgaatcactatcataatgactggtttatagtggacagtttggtgtcaagaattcat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31004497 |
gtttatatatttaaagatagattaagctgaggcagtttccattgtaaatcactatcataatgactggtttatagtggacagtttggtgtcaagaattcat |
31004398 |
T |
 |
| Q |
252 |
tgggatattgt |
262 |
Q |
| |
|
||||||||||| |
|
|
| T |
31004397 |
tgggatattgt |
31004387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University