View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10181_high_4 (Length: 353)
Name: NF10181_high_4
Description: NF10181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10181_high_4 |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0006 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 3 - 343
Target Start/End: Original strand, 80891 - 81231
Alignment:
| Q |
3 |
gcttcaattccatctattcaccccacccagtttgtttattcacttatttgggtggactaaggcgatgcccgctaagaaacgaaagannnnnnnacgtggc |
102 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
80891 |
gcttcaattccatctattcaccccacctagtttgtttattcacttatttgggtggacaaaggcgatgcccgtgaagaaacgaaagaggggggg-cgtggc |
80989 |
T |
 |
| Q |
103 |
ttatttggcatgccgtgatttgggtgatttggaagatgcttaacgatagaatttt-aataatgtggttaaagaggtggacgaaatggtggagcaaattaa |
201 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
80990 |
ttatttggcatgccgtgatatgggtgatttggaagatgcttaacgatagaatttttaataatgttgttaaagaggtggacgaaatggtggagcaaattaa |
81089 |
T |
 |
| Q |
202 |
ggtggtctcatggcattggagcatgaacatattgaatatagcgtcatgtttgttctatacgagtggcgttggaaccctcgcaattgcttggttagatagg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| | |
|
|
| T |
81090 |
ggtggtctcatggcattggagcatgaacatattgaatatagcgtcatgtttgttctatacgagtggcattggaaccctcgcgattgcttggttagataag |
81189 |
T |
 |
| Q |
302 |
tgactgtggacgccgggctgtacatgtgttttggcctctctg |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81190 |
tgactgtggacgccgggctgtacatgtgttttggcctctctg |
81231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 19815994 - 19815939
Alignment:
| Q |
173 |
gaggtggacgaaatggtggagcaaattaaggtggtctcatggcattggagcatgaa |
228 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
19815994 |
gaggtggatgaaatggtggaacaaatcaaggtggtctcgtggcattggagtatgaa |
19815939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 105 - 137
Target Start/End: Original strand, 11678299 - 11678331
Alignment:
| Q |
105 |
atttggcatgccgtgatttgggtgatttggaag |
137 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
11678299 |
atttggcatgccgtaatttgggtgatttggaag |
11678331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University