View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10181_low_12 (Length: 237)
Name: NF10181_low_12
Description: NF10181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10181_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 226
Target Start/End: Original strand, 38326590 - 38326801
Alignment:
| Q |
15 |
aaatgatgattctctttgtcttgatgatccacagagccaatggttccaacttgttgcaaccaatgtttagtttgagtagctagttgctctatcatattat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38326590 |
aaatgatgattctctttgtcttgatgatccacagagccaatggttccaacttgttgcaaccaatgtttagtttgagtaactagttgctctatcatattat |
38326689 |
T |
|
| Q |
115 |
ctttatagtttgtctaattgaattgttttataattatagaacttttaatatgataatcttgttgcaatgttaatgttttgtaaccttctattgtatttaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326690 |
ctttatagtttgtctaattgaattgttttataattatagaacttttaatatgataatcttgttgcaatgttaatgttttgtaaccttctattgtatttaa |
38326789 |
T |
|
| Q |
215 |
ctgtagtttcat |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
38326790 |
gtgtagtttcat |
38326801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 91
Target Start/End: Original strand, 10766448 - 10766522
Alignment:
| Q |
17 |
atgatgattctctttgtcttgatgatccacagagccaatggttccaacttgttgcaaccaatgtttagtttgagt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
10766448 |
atgatgattctctttgtcttgatgatcctcagagccaatggtttcaacttgttgccaccaatgtttagtttgagt |
10766522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 2105598 - 2105643
Alignment:
| Q |
19 |
gatgattctctttgtcttgatgatccacagagccaatggttccaactt |
66 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
2105598 |
gatgattctct--gtcttgatgatccatagagccaatggttccaactt |
2105643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University