View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10181_low_14 (Length: 201)
Name: NF10181_low_14
Description: NF10181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10181_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 13 - 111
Target Start/End: Original strand, 48043635 - 48043734
Alignment:
| Q |
13 |
caaaggatcacacactacttaaatcttttttgtcaggtcttgcttagacaaatccccaggtttgtcaatcttatt-acctagaaccagcagtggaatccc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48043635 |
caaaggatcacacactacttaaatcttttttgtcaggtcttgcttagacaaatccccaggtttgtcaatcttattaacctagaaccagcagtggaatccc |
48043734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 16 - 106
Target Start/End: Original strand, 48051611 - 48051701
Alignment:
| Q |
16 |
aggatcacacactacttaaatcttttttgtcaggtcttgcttagacaaatccccaggtttgtcaatcttattacctagaaccagcagtgga |
106 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||| |
|
|
| T |
48051611 |
aggatcacacactacttaaaccttttctgtcaggtcttgcttagacaaatccccaggtttatcaatcttgttacttagaaccagcagtgga |
48051701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 22 - 99
Target Start/End: Original strand, 48056891 - 48056968
Alignment:
| Q |
22 |
acacactacttaaatcttttttgtcaggtcttgcttagacaaatccccaggtttgtcaatcttattacctagaaccag |
99 |
Q |
| |
|
||||| |||||| ||||||| |||| |||||||||||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
48056891 |
acacagtacttacatcttttctgtcgtgtcttgcttagacaaagcaccaggtttgtcaatcttattaccaagaaccag |
48056968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 110
Target Start/End: Original strand, 48045485 - 48045552
Alignment:
| Q |
43 |
tgtcaggtcttgcttagacaaatccccaggtttgtcaatcttattacctagaaccagcagtggaatcc |
110 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |||||||||| |||||||| | |||||| |
|
|
| T |
48045485 |
tgtcgggtcttgcttagacaaattgtcaggtttgtcaattttattacctaaaaccagcaattgaatcc |
48045552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University