View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10182_high_9 (Length: 332)
Name: NF10182_high_9
Description: NF10182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10182_high_9 |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 18446 - 18761
Alignment:
| Q |
1 |
tttttgaattttggaaaataactttaaaaaacaggtatgtatcattgaaccaatcaatcatttgtttagtttcaggattcacatttgagacagattttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18446 |
tttttgaattttggaaaataactttaaaaaacaagtatatatcattgaaccgatcaatcatttgtttagtttcaggattcacatttgagacagattttgg |
18545 |
T |
 |
| Q |
101 |
aagtatccatttttgatagggtgagagaatatggaacagaaacaattccaagatggccatggttcattttcttaggtggaggaatgtgttgcttactttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18546 |
aagtatccatttttgatagggtgagagaatatggaacagaaacaattccaagatggccatggttcattttcttaggtggaggaatgtgctgcttactttg |
18645 |
T |
 |
| Q |
201 |
cagttcagtttcccatcttcttgcctgccactccaaacgctttagcctgnnnnnnnggcgtctagattatgctggaatatcaattatgataatatgctcc |
300 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18646 |
cagttcagtttcccatcttcttgcttgccactccaaacgatttggcctgtttttttggcgtctagattatgccggaatatcaattatgataatatgctcc |
18745 |
T |
 |
| Q |
301 |
ttctatgctccaattt |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
18746 |
ttctatgctccaattt |
18761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University