View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10182_low_23 (Length: 271)
Name: NF10182_low_23
Description: NF10182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10182_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 31304958 - 31304709
Alignment:
| Q |
19 |
gaagttcctttccaacttcagcatacatccatggtgtcttatccacatcatcaaaaaatacaaaccctggtagcttggtaataacatcatctgaattcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31304958 |
gaagttcctttccaacttcagcatacatccatggtgtcttatccacatcatcaaaaaatacaaaccctggtagcttggtaataacatcatctgaattcac |
31304859 |
T |
 |
| Q |
119 |
tatgcgcaaaacctttgttccttgcttctcaaggtgttgtcgaaaatttctattgcccacacgaggcccaccaaacgagatgactgtcaccattagttta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31304858 |
tatgcgcaaaacctttgttccttgcttctcaaggtgttgtcgaaaatttctattgcccacacgaggcccaccaaacgagatgactgtcaccattagtttg |
31304759 |
T |
 |
| Q |
219 |
ggaacactaatcttaacatcatacgcaatcaacgtagcctatgcttctcc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
31304758 |
ggaacactaatcttaacatcatacgcaatcaacgtagccaatgctgctcc |
31304709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University