View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10182_low_25 (Length: 261)
Name: NF10182_low_25
Description: NF10182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10182_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 29 - 231
Target Start/End: Original strand, 39097571 - 39097774
Alignment:
| Q |
29 |
aagaataagaagagttccgtttcaccttcaattgcagcttgcttctacgggtaactctctcttttcttcccttacaaatccaactaaacattataatgta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39097571 |
aagaataagaagagttccgtttcaccttcaattgcagcttgcttctacgggtaactctctctttacttcccttacaaatgcaactaaacattatcatgta |
39097670 |
T |
|
| Q |
129 |
nnnnnnnnnattta-aaatttattgattcaagttcctttactgcgtgctatttaggttttcacttttccttgttttgtcttatgattcaagctttaagcc |
227 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39097671 |
tttttttttttttttaaatttattgattcaagttcctttactgcgtgctatttaggttttcacttttccttgttttgtcttatgattcaagctttaagcc |
39097770 |
T |
|
| Q |
228 |
tttg |
231 |
Q |
| |
|
|||| |
|
|
| T |
39097771 |
tttg |
39097774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University