View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10182_low_27 (Length: 249)

Name: NF10182_low_27
Description: NF10182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10182_low_27
NF10182_low_27
[»] chr7 (1 HSPs)
chr7 (1-244)||(42413105-42413348)


Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 42413348 - 42413105
Alignment:
Q  1 cattacagcagaggaaaaccctgaaaaccacgagccagaggattttgcagccaccccctcagtctccaatatctcaaacaacatatacctcattgaaacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||    
T  42413348 cattacagcagaggaaaaccctgaaaaccacgagccagaggattttgcagccaccccctcagtctccaatatctcaaacaacatataccttgttgaaacc 42413249  T
Q  101 tcatttttcaactctcatttttctagattgctttgataaatttcaacataaaacccatgtcaaattttcaatttttagctctttttggtcttgatcaccg 200  Q
    |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42413248 tcatttttcaactctcttttttctggattgctttgataaatttcaacataaaacccatgtcaaattttcaatttttagctctttttggtcttgatcaccg 42413149  T
Q  201 ttggggaaatcttgtttctgagaaagttgagtgcctttgcttct 244  Q
    |||||||||||||||||||||||||||||||||| |||||||||    
T  42413148 ttggggaaatcttgtttctgagaaagttgagtgcttttgcttct 42413105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University