View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10182_low_30 (Length: 231)
Name: NF10182_low_30
Description: NF10182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10182_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 25081443 - 25081641
Alignment:
| Q |
18 |
gtggaaaacaaaaaagagtacaattaataactgtggaacttgcaaagaattgattaatacacatgatactaacccctgttgctgcagtccctgtaaatgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25081443 |
gtggaaaacaaaaaagagtacaattaatatctgtggaacttgcaaagaattgattaatacacatgatactaacccctgttgctgcagtccctgtaaacgc |
25081542 |
T |
 |
| Q |
118 |
ccaagccagaggaagcagataccaaggcgctttcgaaatcaaaaatatccccaatgcataagacgtcactgatatcaaaacttttctccatgctttcat |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25081543 |
ccaagcgagaggaagcagataccaaggcgctttcgaaatcaaaaatatccccaatgcataagacgtcactgatatcaaaacttttctccatgctttcat |
25081641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 85 - 158
Target Start/End: Original strand, 54620926 - 54620999
Alignment:
| Q |
85 |
actaacccctgttgctgcagtccctgtaaatgcccaagccagaggaagcagataccaaggcgctttcgaaatca |
158 |
Q |
| |
|
||||||||| ||| | ||||||||||| | ||||||||||||||||| |||||||| || ||||| ||||||| |
|
|
| T |
54620926 |
actaaccccagttacagcagtccctgtccaagcccaagccagaggaagtagataccagggtgctttagaaatca |
54620999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University