View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10182_low_31 (Length: 230)
Name: NF10182_low_31
Description: NF10182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10182_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 34 - 212
Target Start/End: Complemental strand, 41026694 - 41026519
Alignment:
| Q |
34 |
ttagttagtatccatgaaaaggcatttggtgataatatttattctatattcnnnnnnnatggcggaaatatttattctatactcgttataaaagccaaaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41026694 |
ttagttagtatccatgaaaaggcatttggtgataatatttattctatactctttttttatggcggaaatatttattctatactcattataaaagccaaaa |
41026595 |
T |
|
| Q |
134 |
ggttagaaggctttctg-tttccaagttgtcattattaggtcaggacaatcgtgtcccagtcaagcttggtcagccgtct |
212 |
Q |
| |
|
||| ||||||||||||| ||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
41026594 |
ggtaagaaggctttctgttttccaagttgtc---attaggtcaggacaagcgtgt-ccagtcaagcttggtcagccgtct |
41026519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University