View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10183_low_11 (Length: 246)
Name: NF10183_low_11
Description: NF10183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10183_low_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 246
Target Start/End: Complemental strand, 18582424 - 18582192
Alignment:
| Q |
14 |
cagatacgacactgacacgaatacgtggacacatataataagaaaaccatgtgtcaatgtcatgtcagggacgtcggacactaacatttttctaacaccg |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18582424 |
cagacacgacactgacacgaatacgtggacacatataataagaaaaccacgtgtcaatgtcatgttagggacgtcggacactaacatttttctaacaccg |
18582325 |
T |
 |
| Q |
114 |
aacatggcttcaatcattagtgacggtgctacataacttcagacactacatctttcaatttaagaatgtattgtaaatatatacctgcagcatatgtata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18582324 |
aacatggcttcaatcattagtgacggtgctacataacttcagacactacatctttcaatttaagaatgtattgtaaatatatacctgcagcatatgtata |
18582225 |
T |
 |
| Q |
214 |
aactcttcttgttttttcctctctgcttctcca |
246 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
18582224 |
aactcttcttgttttttcctctctgctactcca |
18582192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University