View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10183_low_15 (Length: 232)
Name: NF10183_low_15
Description: NF10183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10183_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 7559328 - 7559532
Alignment:
| Q |
18 |
gcttggtctatatatactaaaacaaaaactggttctggtcttcctaatggtccttttgggttattaggtgctgttgaagggttgtcatatttggcattgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7559328 |
gcttggtctatatatactaaaacaaaaactggttctggtcttcctaatggtccttttgggttattaggtgctgttgaagggttgtcatatttggcattgg |
7559427 |
T |
|
| Q |
118 |
ttgctattgttgttgtttttggtttgcagtattttcaacaaggttacattccaggtcctctccctgctgatcagtgttttggctagattttctgtttttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7559428 |
ttgctattgttgttgtttttggtttgcagtattttcaacaaggttatattccaggtcctctccctgctgatcagtgttttggctagattttctgtttttc |
7559527 |
T |
|
| Q |
218 |
ctttg |
222 |
Q |
| |
|
||||| |
|
|
| T |
7559528 |
ctttg |
7559532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University