View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10184_high_6 (Length: 225)

Name: NF10184_high_6
Description: NF10184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10184_high_6
NF10184_high_6
[»] chr5 (1 HSPs)
chr5 (109-225)||(11178564-11178680)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 109 - 225
Target Start/End: Original strand, 11178564 - 11178680
Alignment:
109 aacaagaagaaaagaagcattattgtaaaaattgattgagtttggtatagtgaaataagagtattgaaaaataactttaccaaactgaaagaatcttgtt 208  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
11178564 aacaagaagaaaagaagtgttattgtaaaaattgattgagtttggtatagtgaaacaagagtattgaaaaataactttaccaaactgaaagaatcttgtt 11178663  T
209 cttggttcttcaagtct 225  Q
    |||||||||||||||||    
11178664 cttggttcttcaagtct 11178680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University