View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10184_low_12 (Length: 279)
Name: NF10184_low_12
Description: NF10184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10184_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 8e-64; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 6942625 - 6942439
Alignment:
| Q |
8 |
gacgtaggcaatattggttgaacttcattaccaaatatcatgtgttcattatttgcgtttactgtttctttaannnnnnnnnnnnngtaccagtttgctg |
107 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||| ||| ||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
6942625 |
gacgtaggcaatattggctgaacttcgttaccaaacatcgtgtgttcattatttgcgtttactgtttctttaattttttgatttttgaaccagtttgctg |
6942526 |
T |
|
| Q |
108 |
ttctaacatacttatgggtaacatgccatgttaacattggtagggaaaccaatgtaaaatgttacattcctcttaaatgtttttctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6942525 |
ttctaacatacttatgggtaacatgccatgttaacattggtagggaaaccaatgtaaactgttacattcctcttaaatgtttttctt |
6942439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 6788101 - 6788160
Alignment:
| Q |
11 |
gtaggcaatattggttgaacttcattaccaaatatcatgtgttcattatttgcgtttact |
70 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
6788101 |
gtaggcaatattggccgaacttcgttaccaaacatcgtgtgtttattatttgcgtttact |
6788160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 6939450 - 6939399
Alignment:
| Q |
8 |
gacgtaggcaatattggttgaacttcattaccaaatatcatgtgttcattat |
59 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||| ||| |||||||||||| |
|
|
| T |
6939450 |
gacgtaggcaatattggctgaacttcgttaccaaacatcgtgtgttcattat |
6939399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 254
Target Start/End: Original strand, 6788244 - 6788323
Alignment:
| Q |
180 |
ttaaatgtttttcttcgctctattgttctctaattatgttg----ttgtaatcatctctattcagt-ttacaaatcttgt |
254 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||| |||||||||||||||| |||| |||||||||||| |
|
|
| T |
6788244 |
ttaaatctttttcttcgatctattgttctctaattgtgttgtaaattgtaatcatctctatccagtaatacaaatcttgt |
6788323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University