View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10184_low_22 (Length: 236)
Name: NF10184_low_22
Description: NF10184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10184_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 30540705 - 30540516
Alignment:
| Q |
13 |
agatgaagttggtgtggttaaagaattggaatcaatttcaaatgaagagaaggttcaatttccagcagtgtttataggtggaaatttgtttggaggattg |
112 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30540705 |
agatgaagttggtttggttaaagaattggaatcaattgcaaatgaagagaaggttcaatttccagcagtgtttataggtggaaatttgtttggaggactg |
30540606 |
T |
|
| Q |
113 |
gatcgaattatggccactcatatttctggtgaattggtccccattcttaaacaagcaggagctttatggctttgactcattaatatcata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30540605 |
gatcgaattatggccactcatatttctggtgaattggtccccattcttaaacaagcaggagctttatggctttgactcattaatatcata |
30540516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 80 - 183
Target Start/End: Complemental strand, 38910144 - 38910041
Alignment:
| Q |
80 |
gtgtttataggtggaaatttgtttggaggattggatcgaattatggccactcatatttctggtgaattggtccccattcttaaacaagcaggagctttat |
179 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||||||| | ||||| ||||||||||||||||||||||| || | ||||||||||| |||||||||| |
|
|
| T |
38910144 |
gtgtttataggtggtaagttgtttggtggattggatcgtctcatggctactcatatttctggtgaattggttccattgcttaaacaagctggagctttat |
38910045 |
T |
|
| Q |
180 |
ggct |
183 |
Q |
| |
|
|||| |
|
|
| T |
38910044 |
ggct |
38910041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University