View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10184_low_23 (Length: 229)
Name: NF10184_low_23
Description: NF10184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10184_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 6 - 183
Target Start/End: Complemental strand, 8869214 - 8869033
Alignment:
| Q |
6 |
actaacacatgatagtgaatgcatccataatattagctcaaacttttggtgctgggatcctattgaatga----ttgttgaggaattggaaaggctattt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8869214 |
actaacacatgatagtgaatgcatccataatattagctcaaacttttggtgctgggatcctattgaatgaatgattgttgaggaattggaaaggctattt |
8869115 |
T |
|
| Q |
102 |
tatcatgagtgatgagaattggcctactacttttgttatcactctggactgtctttggatgtccatcattcacggtcgagct |
183 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8869114 |
tatcatgagtgatgagaattggcttactacttttgttatcactctggactgtctttggatggccatcattcacggtcgagct |
8869033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University