View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10184_low_26 (Length: 203)
Name: NF10184_low_26
Description: NF10184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10184_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 7353724 - 7353555
Alignment:
| Q |
19 |
agtattatactacacacaataagtctcattaacaaatggagcttggataataccgcaagcgtgtgttgttggcttgacttttcaggcatgacagtagtag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7353724 |
agtattatactacacacaataagtctcattaacaaatggagcttggataataccgcaagcatgtgttgttggcttgacttttcaggcatgacagcagtag |
7353625 |
T |
 |
| Q |
119 |
ttgcattgttcaaattggaaccggatgcaccaatagcagcatcattcaaagtttcattttcacccaatac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353624 |
ttgcattgttcaaattggaaccggatgcaccaatagcagcatcattcaaagtttcattttcacccaatac |
7353555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 67
Target Start/End: Complemental strand, 31250381 - 31250335
Alignment:
| Q |
21 |
tattatactacacacaataagtctcattaacaaatggagcttggata |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31250381 |
tattatactacacacaataagtctcattaacaaatggaaattggata |
31250335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University