View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10184_low_7 (Length: 349)
Name: NF10184_low_7
Description: NF10184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10184_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 19 - 349
Target Start/End: Complemental strand, 31762947 - 31762617
Alignment:
| Q |
19 |
ggtgagtgaaacaaacgttaatatttaatagcgtatgcatcaagctacatcacaaaccttaaacaaattattttaaggtataacataacattgttgattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31762947 |
ggtgagtgaaacaaacgttaatatttaatagcgtatgcatcaagctacatcacaaaccttaaacaaattattttaaggtataacataacattgttgattg |
31762848 |
T |
 |
| Q |
119 |
tcatgtactcaccgataactcagcaagcatggaaggcagtgttgagttggtttggtttcttctatcaaatattttctcagattattggatcattcgcgga |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31762847 |
tcatgtactcaccaataactcagcaagcatggaaggcagtgttgagttggtttggtttcttctatcaaatattttctcagattattggatcattcgcgga |
31762748 |
T |
 |
| Q |
219 |
taattatcctttactttctctgtcttccaattcttccttcgaatctctatcatctttggatcatgaatccgctgttcagatcattgaggacgcggatcac |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31762747 |
taattatcctttactttctttgtcttccaattcttccttcaaacctctatcatctttggatcatgaatccgctgttcagatcattgaggacgcggatcac |
31762648 |
T |
 |
| Q |
319 |
caaccgcaacaaaagctcacggtatatatca |
349 |
Q |
| |
|
|||| || ||||||||||||||||||||||| |
|
|
| T |
31762647 |
caacagccacaaaagctcacggtatatatca |
31762617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University