View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_high_14 (Length: 250)
Name: NF10185_high_14
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 20526961 - 20527206
Alignment:
| Q |
8 |
atagatctatagagaaaaacacaaagcaaaacgaagaagcaagtgttaccttaaagaaaaaggtagttggtgaaagaaagagaagttggtgcttgaacag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20526961 |
atagatctatagagaaaaacacaaagcaaaacaaagaagcaagtgttaccttaaagaaaaaggtagttggtgaaagaaagagaagttggtgcttgaacag |
20527060 |
T |
 |
| Q |
108 |
attgaacccgctttgctatggttaagtctgatcaagcgttgtgagtccaaagagaagacttggaactcaatttataggcaaaagtctcaaa--------- |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20527061 |
attgaacccgctttgctatggttaagtctgatcaagcgttgtgagtccaaagagaagacttggaactcaatttataggcaaaagtctcaaatgagagagg |
20527160 |
T |
 |
| Q |
199 |
----tgaggtagttgaagtgtagttaatgactcaaatgcccctttg |
240 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20527161 |
ttgctgaggtagttgaaatgtagttaatgactcaaatgcccctttg |
20527206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University