View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_high_15 (Length: 249)
Name: NF10185_high_15
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 23933975 - 23933738
Alignment:
| Q |
1 |
ttgaggaaacttgaagaattgcacagacaacttcatacacttcaaaaggagaaggttaattccttgcctctcccactctctcttcttttttctctttgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
23933975 |
ttgaggaaacttgaagaattgcacagacaacttcatacacttcaaaaggagaaggttaattccttgcctctcccactctctcttcttttttctct--gtg |
23933878 |
T |
 |
| Q |
101 |
cgtgtgtattattgttctatgaacccaaaatatcatatttattgctgtttattaccgagtgatggtattttatttttgataatgcagagtgatcgtctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
23933877 |
cgtgtgtattattgttctatgaacccaaaatatcatatttattgctgtttattaccgagtgatgatattttatttttaataatgcagagtgatcgtctca |
23933778 |
T |
 |
| Q |
201 |
agaaggtccaagataatctgcacactttaagttctctctg |
240 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23933777 |
agaaggtccaagacaatctgcacactttaagttctctctg |
23933738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University