View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_high_19 (Length: 239)
Name: NF10185_high_19
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 45425096 - 45424874
Alignment:
| Q |
1 |
attattatatgaacttaatacaagaagaatgatagtagcaatttactcactaattgcatgggctaatgattgctttatttattggaccagtcactacctt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45425096 |
attattatatgaacttattacaagaagaatgatagtagcaatttactcactaattgcatgggctaatgattgctttatttattggaccagtcactacctt |
45424997 |
T |
 |
| Q |
101 |
aaaacaactagtatgcatagttacatatacatattaaaatgttagttgataannnnnnnnnnnnnnnnnatagattatataagaacaaatacattttcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45424996 |
-aaacaactagtatgcatagttacatatacatattaaaatgttagttgataatttttttcttttcttttatagattatataagaacaaatacattttcta |
45424898 |
T |
 |
| Q |
201 |
aattatactcagatcgtatatagt |
224 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
45424897 |
aattatactcagattgtatatagt |
45424874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University