View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_high_21 (Length: 229)
Name: NF10185_high_21
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 13271064 - 13270850
Alignment:
| Q |
1 |
tagagaatgtgaatcttttatatgtttctccaatggaatacagtgactattcagttgatcaagttcacaaatcacaagatgctacaacatgtgttgatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13271064 |
tagagaatgtgaatcttttatatgtttctccaatggaatacagtgactattcagttgatcaagttcacaaatcacaagatgctacaacatgtgttgatac |
13270965 |
T |
|
| Q |
101 |
atcttcgggtgcgaatggtccattaaatgatgttgagacaagtaatatcgatgctcacaaactggctgtcgcaggtaagttgatttgtttcgtgaaataa |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13270964 |
atcttcgggtgcgaaaggtccattaaatgatgttgagacaagtaatatcgatgctcacaaactggctgtcgcaggtaagttgatttgtttcgtgaaataa |
13270865 |
T |
|
| Q |
201 |
tctatggtcatagtg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13270864 |
tctatggtcatagtg |
13270850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University