View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_high_7 (Length: 421)
Name: NF10185_high_7
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 5e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 160 - 298
Target Start/End: Complemental strand, 33593695 - 33593555
Alignment:
| Q |
160 |
taagggtttaagggagatagtggacgtggagatggtgaatggagagagtcttgtggcggtggaaggttgaggcagaagaagtagcagcaacgacatggac |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33593695 |
taagggtttaagggagatagtggacgtggagatggtgaatggagagagtcttgtggcggtggaaggttgaggcagaagaagtagcaggaacgacatggac |
33593596 |
T |
 |
| Q |
260 |
tctg--ctactacaacaacacagttccggttaggataatgg |
298 |
Q |
| |
|
|||| || |||| ||||||||||||||||||||||||||| |
|
|
| T |
33593595 |
tctgctctgctactacaacacagttccggttaggataatgg |
33593555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 18 - 96
Target Start/End: Complemental strand, 33593846 - 33593768
Alignment:
| Q |
18 |
ggattaagataactgcttccatttcctcggtgccgaaaccgatgggaagaagaactttctttggagggggtgcatttgt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33593846 |
ggattaagataactgcttccatttcctcggtgccgaaaccgatgggaagaagaactttctttggagggggtgcatttgt |
33593768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University