View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_low_19 (Length: 283)
Name: NF10185_low_19
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 4 - 269
Target Start/End: Original strand, 2018507 - 2018772
Alignment:
| Q |
4 |
gtcaatgagatggacatcactctggctctccctccgttccttcgaccttgatgacaactacttttccgacttccacaggttttccaatttcttcacctca |
103 |
Q |
| |
|
||||| |||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2018507 |
gtcaaagagatggaaaccactctggctctccttccgttccttcgaccttgatgacaactacttttccgacttccacaggttttccaatttcgtcacctca |
2018606 |
T |
|
| Q |
104 |
tcaccacaatccattcaatccttacgcctcacttgtggctcccattttaccttcgagttcgaggacgtcgaagaagatgctttcgacctcttcctttata |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018607 |
tcaccacaatccattcaatccttacgcctcacttgtggctcccattttaccttcgagttcgaggacgtcgaagaagatgctttcgacctcttcctttata |
2018706 |
T |
|
| Q |
204 |
gactgtcgttcaaaggaattcaggaactcgatctctgcttggtcactttaatcgaattgccttttg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018707 |
gactgtcgttcaaaggaattcaggaactcgatctctgcttggtcactttaatcgaattgccttttg |
2018772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University