View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_low_20 (Length: 280)
Name: NF10185_low_20
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_low_20 |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 107 - 264
Target Start/End: Complemental strand, 35443146 - 35442988
Alignment:
| Q |
107 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttt-gattagtaaatagtagatagg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35443146 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
35443047 |
T |
 |
| Q |
206 |
gtttgtttggttacaaaatgctaaaaatacatatatttatgtaaaataagtggttaaat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35443046 |
gtttgtttggttacaaaatgctaaaaatacatatatttatttaaaataagtggttaaat |
35442988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 78
Target Start/End: Complemental strand, 1949671 - 1949599
Alignment:
| Q |
6 |
aggagcagagataccagatgcaggagcagcgagatcaatttttaatggaccagaatgctgcgcttttcaggag |
78 |
Q |
| |
|
|||| |||||||| |||| |||||||||| ||||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
1949671 |
aggaacagagatatcagagacaggagcagcaggatcatttcataatggaccagaacgctgcgcttttcaggag |
1949599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 11 - 93
Target Start/End: Original strand, 183314 - 183396
Alignment:
| Q |
11 |
cagagataccagatgcaggagcagcgagatcaatttttaatggaccagaatgctgcgcttttcaggagccatcgaggtatcta |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
183314 |
cagagataccagatgcaggagcagcgagatcattttttaatggaccagaatgctgcgcttttcagaagccatcgaggtatcta |
183396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 353440 - 353355
Alignment:
| Q |
8 |
gagcagagataccagatgcaggagcagcgagatcaatttttaatggaccagaatgctgcgcttttcaggagccatcgaggtatcta |
93 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
353440 |
gagcagagatatcagagacaggagcagcgagatcattttttaatggaccagaatgctgcgcttttcaggagccaccgaggcatcta |
353355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 8 - 93
Target Start/End: Original strand, 27351605 - 27351690
Alignment:
| Q |
8 |
gagcagagataccagatgcaggagcagcgagatcaatttttaatggaccagaatgctgcgcttttcaggagccatcgaggtatcta |
93 |
Q |
| |
|
||||||||||| |||| || ||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
27351605 |
gagcagagatatcagagacaagagcagcaagatcattttttaatggaccagaatgctgcgcttttcaggagccaccgaggcatcta |
27351690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 230 - 259
Target Start/End: Original strand, 16780329 - 16780358
Alignment:
| Q |
230 |
aaatacatatatttatgtaaaataagtggt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16780329 |
aaatacatatatttatgtaaaataagtggt |
16780358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 8 - 93
Target Start/End: Original strand, 29224847 - 29224933
Alignment:
| Q |
8 |
gagcagagataccagatgcaggagcagcgagatcaatttt-taatggaccagaatgctgcgcttttcaggagccatcgaggtatcta |
93 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
29224847 |
gagcagagatatcagagacaggagcagcgagatcatttttttaatggaccagaatgctgcacttttcaggagccaccgaggcatcta |
29224933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 8 - 93
Target Start/End: Original strand, 29338146 - 29338232
Alignment:
| Q |
8 |
gagcagagataccagatgcaggagcagcgagatcaatttt-taatggaccagaatgctgcgcttttcaggagccatcgaggtatcta |
93 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
29338146 |
gagcagagatatcagagacaggagcagcgagatcatttttttaatggaccagaatgctgcacttttcaggagccaccgaggcatcta |
29338232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University