View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_low_21 (Length: 272)
Name: NF10185_low_21
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_low_21 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 11 - 272
Target Start/End: Original strand, 45693136 - 45693397
Alignment:
| Q |
11 |
aagaaaacattgaagcacttggcattggcatgtgcagtccctgaccagcttgaagcccaaacatttgaggatttggtcttgccatcccatgtaaagcagc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45693136 |
aagaaaacattgaagcacttggcattggcatgtgcagtccctgaccagcttgaagcccaaacatttgaggatttggtcttaccatcccatgtaaagcagc |
45693235 |
T |
 |
| Q |
111 |
aagtccagatgtatgtgcaacaggaaggtgagttccttcaaattgaggcacccccaatcccatttgcatggcaacactcatgggtgaaaagggaaacatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45693236 |
aagtccagatgtatgtgcaacaggaaggtgagttccttgaaattgaggcacccccaatcccatttgcatggcaacactcatgggtgaaaagggaaacatg |
45693335 |
T |
 |
| Q |
211 |
tgagccgcatgcatgtgctgcattcctgctggtaacatcataggcatgtataaaccaccacc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45693336 |
tgagccgcatgcatgtgctgcattcctgctggtaacgtcataggcatgtataaaccaccacc |
45693397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University