View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_low_22 (Length: 264)
Name: NF10185_low_22
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_low_22 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 39 - 264
Target Start/End: Original strand, 38392531 - 38392756
Alignment:
| Q |
39 |
atccagtctctttctctgaatgcaacggtaagtcctaatgaaaataacaagactcataatgcaaattttatcgggttgaaactaaacttgttgtgtcaat |
138 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38392531 |
atccagtctctttctctgaatgcaatggtaagtcctaatgaaaataaaaagactcataatgcaaattttatcgggttgaaattaaacttgttgtgtcaat |
38392630 |
T |
|
| Q |
139 |
gcaagtggaaacttcaatcacttggttggcttatatgttatgttgctgcatgctactattgatatttgccacagaatatagtgatcctaatgatgaatcg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38392631 |
gcaagtggaaacttcaatcacttggttggcttatatgttatgttgctgcatgctactattgatatttgccacagaatatagtgatcctaatgatgaatcg |
38392730 |
T |
|
| Q |
239 |
agaccttcaatgttgagttctagact |
264 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
38392731 |
aaaccttcaatgttgagttctagact |
38392756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University