View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_low_31 (Length: 239)
Name: NF10185_low_31
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 4270896 - 4270681
Alignment:
| Q |
1 |
tatatttatatccatgtatagtagccagtaaccttctattgatcacattgacatatccatattctctctagtttctggtattttctattccactaccact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4270896 |
tatatttatatccatgtatagtagccagtaaccttctattgatcacattgatatatccatattctctctagtttctggtattttctattccactaccact |
4270797 |
T |
|
| Q |
101 |
aagtgcaagtattagttgacatccatattctctctagtttgtgtatgcattaccatttaccatgcaattgttctttgaaaaaatgaaatagaaaaggaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4270796 |
aagtgcaagtattagttgacatccatattctctctagtttgtgtatgta-------ttaccatgcaattgttctttgaaaaaatgaaatagaaaaggaat |
4270704 |
T |
|
| Q |
201 |
aaaggacacgtataacagagtcc |
223 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
4270703 |
aagggacacgtataacagagtcc |
4270681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University