View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10185_low_33 (Length: 238)
Name: NF10185_low_33
Description: NF10185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10185_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 50602176 - 50601966
Alignment:
| Q |
12 |
catacatagaaccgctcattcaagaaagtgaaaatatgtgtgctaaccgagggagatgtctgcaccttatttcgatcgcatacggtaaggagttcgatga |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50602176 |
catatatagaaccgctcattcaagaaagtgaaaatatgtgtgctaaccgagggagatgtctgcaccttatttcgatcgcatacggtaaggagttcgatga |
50602077 |
T |
 |
| Q |
112 |
tgatatgttagtcgattcaacaaacaaatattctaacaattcatgagaaggccaaactgaatatgcctttgacataacaaaagttgggcatatattttac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50602076 |
tgatatgttagtcgattcaacaaacaaatattctaacaattcatgagaaggccaaactgaatatgcctttgacataacaaaagttgggcatatattctac |
50601977 |
T |
 |
| Q |
212 |
tatctgcttaa |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
50601976 |
tatctgcttaa |
50601966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University