View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10186_high_11 (Length: 323)

Name: NF10186_high_11
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10186_high_11
NF10186_high_11
[»] chr4 (1 HSPs)
chr4 (127-240)||(36513410-36513523)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 127 - 240
Target Start/End: Original strand, 36513410 - 36513523
Alignment:
127 taaggggagtttacggagtagtttttaagattaatttttaattctttaacggttgtcttacacgacatgtttaagtgagatccaattaattttgatttga 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36513410 taaggggagtttacggagtagtttttaagattaatttttaattctttaacggttgtcttacacgacatgtttaagtgagatccaattaattttgatttga 36513509  T
227 agtaatatgaaaat 240  Q
    ||||||||||||||    
36513510 agtaatatgaaaat 36513523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University