View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10186_high_22 (Length: 239)

Name: NF10186_high_22
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10186_high_22
NF10186_high_22
[»] chr3 (2 HSPs)
chr3 (5-69)||(19224315-19224379)
chr3 (127-223)||(19224437-19224531)


Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 19224315 - 19224379
Alignment:
5 ttatatcaaacctttagcatgggatatttttgaaggaaaacctttagcatgggaaattgtaggac 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
19224315 ttatatcaaacctttagcatgggatatttttgaaggaaaacctttagcatgggatattgtaggac 19224379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 127 - 223
Target Start/End: Original strand, 19224437 - 19224531
Alignment:
127 gaacaatcattttgctaagtaactttagtgacttcattacaaaatgnnnnnnnnncttgtttagtgaaatcacaaattttgttattcacgtcatgag 223  Q
    |||||||||||||||||||||||||||||||||||||| |||||||         ||||||||||||||||||||||||||||||||||||||||||    
19224437 gaacaatcattttgctaagtaactttagtgacttcattgcaaaatg--tttttttcttgtttagtgaaatcacaaattttgttattcacgtcatgag 19224531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University