View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10186_high_26 (Length: 219)
Name: NF10186_high_26
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10186_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 30965512 - 30965308
Alignment:
| Q |
1 |
catcccttttctccttcatcctcaagcgctgctcacggccctctccaaagtaaaattgatacattctatgaacattataaaatgtttgaattatctccac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30965512 |
catcccttttctccttcatcctcaagcgctgctcacggccctctccaaagtaaaattgatacattctatgaacattataaaatgtttgaattatccccac |
30965413 |
T |
 |
| Q |
101 |
aatgatatggataataatgatgacaaaaaccacataagaaccatatttaatcttttctattagatagaccactgaatcatgaccagtagtaagtccaagg |
200 |
Q |
| |
|
|||| | | ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30965412 |
aatggttttgataataatgatgacaaaaactacataaaaaccatatttaatcttttctattagatagagcactgaatcatgaccagtagtaagtccaagg |
30965313 |
T |
 |
| Q |
201 |
ttctt |
205 |
Q |
| |
|
||||| |
|
|
| T |
30965312 |
ttctt |
30965308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University