View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10186_low_12 (Length: 365)
Name: NF10186_low_12
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10186_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 17 - 348
Target Start/End: Original strand, 42621955 - 42622286
Alignment:
| Q |
17 |
gtaggttggggtaatttgaagtgtctgtgtcttgtactcatcattagcatgataccaaaacttggcaacaatttttgccatttataactgttgtccacta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42621955 |
gtaggttggggtaatttgaagtgtctgtgtcttgtactcatcattagcatgataccaaaacttggcaacaatttttgccatttataactgttgtccacta |
42622054 |
T |
|
| Q |
117 |
cagaaactgacctctgctaactcaatgatctatatggacctatttcaagttgctgtgacatattgaaaacattctcaacgcattttgaactaatcaacgc |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622055 |
aagaaactgaactctgctaactcaatgatctatatggacctgtttcaagttgctgtgacatattgaaaacattctcaacgcattttgaactaatcaacgc |
42622154 |
T |
|
| Q |
217 |
tcgatggcttagtcacagttaaatttcttcacgaaaagagttgataaatcacattgtttgaaaaacctttgcaattggcaatgacctgagttatttcaaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622155 |
tcgatggcttagtcacagttaaatttcttcacgaaaagagttgataaatcacattgtttgaaaaacctttgcaattggcaatgacctgagttatttcaaa |
42622254 |
T |
|
| Q |
317 |
tttctttgtgagaacaccaacaagctccttct |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42622255 |
tttctttgtgagaacaccaacaagctccttct |
42622286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University