View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10186_low_21 (Length: 255)
Name: NF10186_low_21
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10186_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 238
Target Start/End: Original strand, 22314442 - 22314677
Alignment:
| Q |
5 |
aataatatcataaaaccatcaacaaagacattaaatctaaaaccaaacaatgttggagtggccaaaacacaaagatgccatggtgactttggaggggtc- |
103 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22314442 |
aataatatcataaaaccaccaacaaagacatcaaatctaaaaccaaacaatgttggagtggccaaaacacaaagatgccatggtgactttggaggggtct |
22314541 |
T |
|
| Q |
104 |
-acttggaagttgattcagtaattgaggttgcaatttaatgtagcgacaagatttagatgtaatggatgatgtgagtatgatcaacaagagaggaacttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
22314542 |
cacttggaagttgattcagtaattgaggttgcaaattaatgtagcgacaagatttagatgtaatggatgacgtgagtatgatcaaccagagaggaacttg |
22314641 |
T |
|
| Q |
203 |
taatgatctgctgatgttggatttaaccattaacta |
238 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22314642 |
taatgatatgctgatgttggatttaaccattaacta |
22314677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University