View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10186_low_27 (Length: 241)
Name: NF10186_low_27
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10186_low_27 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 9408351 - 9408571
Alignment:
| Q |
19 |
gcatagaggcatgcacattggtcaagcgttgttccctcttgagaatcaaattctgcattcgctacatctttgaaaggagttccttttactactggagctc |
118 |
Q |
| |
|
|||||||||||||| |||||| ||| | |||||||||| ||||||||||| || | ||||||||| | |||| |||| ||||| |||| ||||||| |
|
|
| T |
9408351 |
gcatagaggcatgcgcattggccaaacattgttccctcctgagaatcaaactcggtattcgctacgtttttggtaggaactccttg--ctaccggagctc |
9408448 |
T |
 |
| Q |
119 |
atacaacttggttaattaagaattactttacaaaatagaaaacgtgttttttccattgtacttataatcccctcgtgaaatttaatgnnnnnnnnncttt |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9408449 |
aagcaacttggttaattaagaattactttacaaaatagaaaacgtgttttttccattgtacttataatcccctcgtgaaatttaatgtttttttttcttt |
9408548 |
T |
 |
| Q |
219 |
tctattatctcttttgtacttat |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9408549 |
tctattatctcttttgtacttat |
9408571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 29410788 - 29410824
Alignment:
| Q |
19 |
gcatagaggcatgcacattggtcaagcgttgttccct |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29410788 |
gcatagaggcatgcacattggtcaagcgttgttccct |
29410824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 57
Target Start/End: Original strand, 30927781 - 30927816
Alignment:
| Q |
22 |
tagaggcatgcacattggtcaagcgttgttccctct |
57 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30927781 |
tagaggcatgcacattggccaagcgttgttccctct |
30927816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 71
Target Start/End: Original strand, 37319943 - 37319992
Alignment:
| Q |
22 |
tagaggcatgcacattggtcaagcgttgttccctcttgagaatcaaattc |
71 |
Q |
| |
|
|||||||||||||| | ||||||||||||| | || |||||||||||||| |
|
|
| T |
37319943 |
tagaggcatgcacacttgtcaagcgttgtttcatcctgagaatcaaattc |
37319992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 54
Target Start/End: Complemental strand, 149441 - 149409
Alignment:
| Q |
22 |
tagaggcatgcacattggtcaagcgttgttccc |
54 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
149441 |
tagaggcatgcacactggtcaagcgttgttccc |
149409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University