View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10186_low_30 (Length: 239)
Name: NF10186_low_30
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10186_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 19224315 - 19224379
Alignment:
| Q |
5 |
ttatatcaaacctttagcatgggatatttttgaaggaaaacctttagcatgggaaattgtaggac |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19224315 |
ttatatcaaacctttagcatgggatatttttgaaggaaaacctttagcatgggatattgtaggac |
19224379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 127 - 223
Target Start/End: Original strand, 19224437 - 19224531
Alignment:
| Q |
127 |
gaacaatcattttgctaagtaactttagtgacttcattacaaaatgnnnnnnnnncttgtttagtgaaatcacaaattttgttattcacgtcatgag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19224437 |
gaacaatcattttgctaagtaactttagtgacttcattgcaaaatg--tttttttcttgtttagtgaaatcacaaattttgttattcacgtcatgag |
19224531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University